ID: 1061208912

View in Genome Browser
Species Human (GRCh38)
Location 9:129179449-129179471
Sequence CCAAGAGGCCTGAAGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061208905_1061208912 -2 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208912 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061208912 Original CRISPR CCAAGAGGCCTGAAGGGGGC TGG Intergenic
No off target data available for this crispr