ID: 1061208914

View in Genome Browser
Species Human (GRCh38)
Location 9:129179463-129179485
Sequence GGGGGCTGGTTGCTGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061208905_1061208914 12 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208914 9:129179463-129179485 GGGGGCTGGTTGCTGCTCCCAGG No data
1061208911_1061208914 -9 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208914 9:129179463-129179485 GGGGGCTGGTTGCTGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061208914 Original CRISPR GGGGGCTGGTTGCTGCTCCC AGG Intergenic
No off target data available for this crispr