ID: 1061208915

View in Genome Browser
Species Human (GRCh38)
Location 9:129179464-129179486
Sequence GGGGCTGGTTGCTGCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061208911_1061208915 -8 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208915 9:129179464-129179486 GGGGCTGGTTGCTGCTCCCAGGG No data
1061208905_1061208915 13 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208915 9:129179464-129179486 GGGGCTGGTTGCTGCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061208915 Original CRISPR GGGGCTGGTTGCTGCTCCCA GGG Intergenic
No off target data available for this crispr