ID: 1061208920

View in Genome Browser
Species Human (GRCh38)
Location 9:129179481-129179503
Sequence CCAGGGGTTTCAAAGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061208911_1061208920 9 Left 1061208911 9:129179449-129179471 CCAAGAGGCCTGAAGGGGGCTGG No data
Right 1061208920 9:129179481-129179503 CCAGGGGTTTCAAAGGTGCCTGG No data
1061208913_1061208920 1 Left 1061208913 9:129179457-129179479 CCTGAAGGGGGCTGGTTGCTGCT No data
Right 1061208920 9:129179481-129179503 CCAGGGGTTTCAAAGGTGCCTGG No data
1061208905_1061208920 30 Left 1061208905 9:129179428-129179450 CCTGGGGGCGCTCTATCTGGACC No data
Right 1061208920 9:129179481-129179503 CCAGGGGTTTCAAAGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061208920 Original CRISPR CCAGGGGTTTCAAAGGTGCC TGG Intergenic
No off target data available for this crispr