ID: 1061212704

View in Genome Browser
Species Human (GRCh38)
Location 9:129203027-129203049
Sequence CCCGGCGCCCGCGCGGCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061212700_1061212704 4 Left 1061212700 9:129203000-129203022 CCGCTGGCGCGGACGTTCGCGGA No data
Right 1061212704 9:129203027-129203049 CCCGGCGCCCGCGCGGCTCACGG No data
1061212692_1061212704 20 Left 1061212692 9:129202984-129203006 CCTGTCCCCCGGGCAGCCGCTGG No data
Right 1061212704 9:129203027-129203049 CCCGGCGCCCGCGCGGCTCACGG No data
1061212694_1061212704 15 Left 1061212694 9:129202989-129203011 CCCCCGGGCAGCCGCTGGCGCGG No data
Right 1061212704 9:129203027-129203049 CCCGGCGCCCGCGCGGCTCACGG No data
1061212697_1061212704 13 Left 1061212697 9:129202991-129203013 CCCGGGCAGCCGCTGGCGCGGAC No data
Right 1061212704 9:129203027-129203049 CCCGGCGCCCGCGCGGCTCACGG No data
1061212691_1061212704 21 Left 1061212691 9:129202983-129203005 CCCTGTCCCCCGGGCAGCCGCTG No data
Right 1061212704 9:129203027-129203049 CCCGGCGCCCGCGCGGCTCACGG No data
1061212698_1061212704 12 Left 1061212698 9:129202992-129203014 CCGGGCAGCCGCTGGCGCGGACG No data
Right 1061212704 9:129203027-129203049 CCCGGCGCCCGCGCGGCTCACGG No data
1061212696_1061212704 14 Left 1061212696 9:129202990-129203012 CCCCGGGCAGCCGCTGGCGCGGA No data
Right 1061212704 9:129203027-129203049 CCCGGCGCCCGCGCGGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061212704 Original CRISPR CCCGGCGCCCGCGCGGCTCA CGG Intergenic