ID: 1061213223

View in Genome Browser
Species Human (GRCh38)
Location 9:129205408-129205430
Sequence TAGTGGTGGTGGGCACTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061213217_1061213223 10 Left 1061213217 9:129205375-129205397 CCAGGAATATGGATTTTTAAGCA No data
Right 1061213223 9:129205408-129205430 TAGTGGTGGTGGGCACTGAGTGG No data
1061213216_1061213223 20 Left 1061213216 9:129205365-129205387 CCATGCTCAGCCAGGAATATGGA No data
Right 1061213223 9:129205408-129205430 TAGTGGTGGTGGGCACTGAGTGG No data
1061213214_1061213223 23 Left 1061213214 9:129205362-129205384 CCACCATGCTCAGCCAGGAATAT No data
Right 1061213223 9:129205408-129205430 TAGTGGTGGTGGGCACTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061213223 Original CRISPR TAGTGGTGGTGGGCACTGAG TGG Intergenic
No off target data available for this crispr