ID: 1061213436

View in Genome Browser
Species Human (GRCh38)
Location 9:129206527-129206549
Sequence GGGACCTGAGGGTGACTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061213436_1061213442 5 Left 1061213436 9:129206527-129206549 CCTCTCAGTCACCCTCAGGTCCC No data
Right 1061213442 9:129206555-129206577 GAAGTGGTCCCCTGTCCTTCAGG No data
1061213436_1061213448 29 Left 1061213436 9:129206527-129206549 CCTCTCAGTCACCCTCAGGTCCC No data
Right 1061213448 9:129206579-129206601 GCACACCTGTCATCCCAGGCTGG No data
1061213436_1061213447 25 Left 1061213436 9:129206527-129206549 CCTCTCAGTCACCCTCAGGTCCC No data
Right 1061213447 9:129206575-129206597 AGGAGCACACCTGTCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061213436 Original CRISPR GGGACCTGAGGGTGACTGAG AGG (reversed) Intergenic