ID: 1061216131

View in Genome Browser
Species Human (GRCh38)
Location 9:129223033-129223055
Sequence CGGCCTCAGAGGGGACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061216131_1061216142 13 Left 1061216131 9:129223033-129223055 CCTCCCTGTCCCCTCTGAGGCCG No data
Right 1061216142 9:129223069-129223091 GTGTGTCCCCGTCTCTGAACTGG No data
1061216131_1061216143 14 Left 1061216131 9:129223033-129223055 CCTCCCTGTCCCCTCTGAGGCCG No data
Right 1061216143 9:129223070-129223092 TGTGTCCCCGTCTCTGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061216131 Original CRISPR CGGCCTCAGAGGGGACAGGG AGG (reversed) Intergenic
No off target data available for this crispr