ID: 1061216142

View in Genome Browser
Species Human (GRCh38)
Location 9:129223069-129223091
Sequence GTGTGTCCCCGTCTCTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061216139_1061216142 -10 Left 1061216139 9:129223056-129223078 CCGTTTCCCAGGTGTGTGTCCCC No data
Right 1061216142 9:129223069-129223091 GTGTGTCCCCGTCTCTGAACTGG No data
1061216131_1061216142 13 Left 1061216131 9:129223033-129223055 CCTCCCTGTCCCCTCTGAGGCCG No data
Right 1061216142 9:129223069-129223091 GTGTGTCCCCGTCTCTGAACTGG No data
1061216134_1061216142 4 Left 1061216134 9:129223042-129223064 CCCCTCTGAGGCCGCCGTTTCCC No data
Right 1061216142 9:129223069-129223091 GTGTGTCCCCGTCTCTGAACTGG No data
1061216132_1061216142 10 Left 1061216132 9:129223036-129223058 CCCTGTCCCCTCTGAGGCCGCCG No data
Right 1061216142 9:129223069-129223091 GTGTGTCCCCGTCTCTGAACTGG No data
1061216136_1061216142 2 Left 1061216136 9:129223044-129223066 CCTCTGAGGCCGCCGTTTCCCAG No data
Right 1061216142 9:129223069-129223091 GTGTGTCCCCGTCTCTGAACTGG No data
1061216138_1061216142 -7 Left 1061216138 9:129223053-129223075 CCGCCGTTTCCCAGGTGTGTGTC No data
Right 1061216142 9:129223069-129223091 GTGTGTCCCCGTCTCTGAACTGG No data
1061216135_1061216142 3 Left 1061216135 9:129223043-129223065 CCCTCTGAGGCCGCCGTTTCCCA No data
Right 1061216142 9:129223069-129223091 GTGTGTCCCCGTCTCTGAACTGG No data
1061216133_1061216142 9 Left 1061216133 9:129223037-129223059 CCTGTCCCCTCTGAGGCCGCCGT No data
Right 1061216142 9:129223069-129223091 GTGTGTCCCCGTCTCTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061216142 Original CRISPR GTGTGTCCCCGTCTCTGAAC TGG Intergenic
No off target data available for this crispr