ID: 1061218733

View in Genome Browser
Species Human (GRCh38)
Location 9:129236766-129236788
Sequence CCCGGCTGCCCCGTGTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061218733_1061218742 11 Left 1061218733 9:129236766-129236788 CCTGGGAACACGGGGCAGCCGGG No data
Right 1061218742 9:129236800-129236822 AAGCCAAGCCTGTGTGTGGTAGG No data
1061218733_1061218744 13 Left 1061218733 9:129236766-129236788 CCTGGGAACACGGGGCAGCCGGG No data
Right 1061218744 9:129236802-129236824 GCCAAGCCTGTGTGTGGTAGGGG No data
1061218733_1061218743 12 Left 1061218733 9:129236766-129236788 CCTGGGAACACGGGGCAGCCGGG No data
Right 1061218743 9:129236801-129236823 AGCCAAGCCTGTGTGTGGTAGGG No data
1061218733_1061218740 7 Left 1061218733 9:129236766-129236788 CCTGGGAACACGGGGCAGCCGGG No data
Right 1061218740 9:129236796-129236818 CCCAAAGCCAAGCCTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061218733 Original CRISPR CCCGGCTGCCCCGTGTTCCC AGG (reversed) Intergenic