ID: 1061219775

View in Genome Browser
Species Human (GRCh38)
Location 9:129243455-129243477
Sequence TCGGCAGCTTGTCCTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061219772_1061219775 2 Left 1061219772 9:129243430-129243452 CCTGTGCTGCTGGGAGGTAGAGG No data
Right 1061219775 9:129243455-129243477 TCGGCAGCTTGTCCTCCTTGTGG No data
1061219768_1061219775 30 Left 1061219768 9:129243402-129243424 CCACGAGGTGCTGGCAAGCTCTC No data
Right 1061219775 9:129243455-129243477 TCGGCAGCTTGTCCTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061219775 Original CRISPR TCGGCAGCTTGTCCTCCTTG TGG Intergenic
No off target data available for this crispr