ID: 1061223242

View in Genome Browser
Species Human (GRCh38)
Location 9:129264736-129264758
Sequence ATGTGGGCTGGGATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061223234_1061223242 14 Left 1061223234 9:129264699-129264721 CCTCCTACCTCACGAAATGGCTG No data
Right 1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG No data
1061223231_1061223242 23 Left 1061223231 9:129264690-129264712 CCAGTCCTGCCTCCTACCTCACG No data
Right 1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG No data
1061223235_1061223242 11 Left 1061223235 9:129264702-129264724 CCTACCTCACGAAATGGCTGAGA No data
Right 1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG No data
1061223232_1061223242 18 Left 1061223232 9:129264695-129264717 CCTGCCTCCTACCTCACGAAATG No data
Right 1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG No data
1061223236_1061223242 7 Left 1061223236 9:129264706-129264728 CCTCACGAAATGGCTGAGATTGA No data
Right 1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061223242 Original CRISPR ATGTGGGCTGGGATTGAGGA AGG Intergenic
No off target data available for this crispr