ID: 1061225946

View in Genome Browser
Species Human (GRCh38)
Location 9:129281051-129281073
Sequence CTGTCCACACAGGCCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061225946_1061225951 6 Left 1061225946 9:129281051-129281073 CCAGCTGGGGCCTGTGTGGACAG No data
Right 1061225951 9:129281080-129281102 CACTGTCTCCACTGCATGCAGGG No data
1061225946_1061225953 16 Left 1061225946 9:129281051-129281073 CCAGCTGGGGCCTGTGTGGACAG No data
Right 1061225953 9:129281090-129281112 ACTGCATGCAGGGAGTCTTGAGG No data
1061225946_1061225950 5 Left 1061225946 9:129281051-129281073 CCAGCTGGGGCCTGTGTGGACAG No data
Right 1061225950 9:129281079-129281101 TCACTGTCTCCACTGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061225946 Original CRISPR CTGTCCACACAGGCCCCAGC TGG (reversed) Intergenic
No off target data available for this crispr