ID: 1061225953

View in Genome Browser
Species Human (GRCh38)
Location 9:129281090-129281112
Sequence ACTGCATGCAGGGAGTCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061225949_1061225953 -10 Left 1061225949 9:129281077-129281099 CCTCACTGTCTCCACTGCATGCA No data
Right 1061225953 9:129281090-129281112 ACTGCATGCAGGGAGTCTTGAGG No data
1061225946_1061225953 16 Left 1061225946 9:129281051-129281073 CCAGCTGGGGCCTGTGTGGACAG No data
Right 1061225953 9:129281090-129281112 ACTGCATGCAGGGAGTCTTGAGG No data
1061225948_1061225953 6 Left 1061225948 9:129281061-129281083 CCTGTGTGGACAGAGGCCTCACT No data
Right 1061225953 9:129281090-129281112 ACTGCATGCAGGGAGTCTTGAGG No data
1061225945_1061225953 17 Left 1061225945 9:129281050-129281072 CCCAGCTGGGGCCTGTGTGGACA No data
Right 1061225953 9:129281090-129281112 ACTGCATGCAGGGAGTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061225953 Original CRISPR ACTGCATGCAGGGAGTCTTG AGG Intergenic