ID: 1061226076

View in Genome Browser
Species Human (GRCh38)
Location 9:129281695-129281717
Sequence CGCTGGGAGTGGAGGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061226063_1061226076 20 Left 1061226063 9:129281652-129281674 CCCTAGAGAAAGCGTGGCACATC No data
Right 1061226076 9:129281695-129281717 CGCTGGGAGTGGAGGGCTGAGGG No data
1061226064_1061226076 19 Left 1061226064 9:129281653-129281675 CCTAGAGAAAGCGTGGCACATCT No data
Right 1061226076 9:129281695-129281717 CGCTGGGAGTGGAGGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061226076 Original CRISPR CGCTGGGAGTGGAGGGCTGA GGG Intergenic
No off target data available for this crispr