ID: 1061226076 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:129281695-129281717 |
Sequence | CGCTGGGAGTGGAGGGCTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1061226063_1061226076 | 20 | Left | 1061226063 | 9:129281652-129281674 | CCCTAGAGAAAGCGTGGCACATC | No data | ||
Right | 1061226076 | 9:129281695-129281717 | CGCTGGGAGTGGAGGGCTGAGGG | No data | ||||
1061226064_1061226076 | 19 | Left | 1061226064 | 9:129281653-129281675 | CCTAGAGAAAGCGTGGCACATCT | No data | ||
Right | 1061226076 | 9:129281695-129281717 | CGCTGGGAGTGGAGGGCTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1061226076 | Original CRISPR | CGCTGGGAGTGGAGGGCTGA GGG | Intergenic | ||
No off target data available for this crispr |