ID: 1061229738

View in Genome Browser
Species Human (GRCh38)
Location 9:129308257-129308279
Sequence CAGTTTCTCCATCTTGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061229738_1061229740 -5 Left 1061229738 9:129308257-129308279 CCATGTACAAGATGGAGAAACTG No data
Right 1061229740 9:129308275-129308297 AACTGAGGCATGAGAAGAACTGG No data
1061229738_1061229742 14 Left 1061229738 9:129308257-129308279 CCATGTACAAGATGGAGAAACTG No data
Right 1061229742 9:129308294-129308316 CTGGTTACCGACTTGACCCAGGG No data
1061229738_1061229741 13 Left 1061229738 9:129308257-129308279 CCATGTACAAGATGGAGAAACTG No data
Right 1061229741 9:129308293-129308315 ACTGGTTACCGACTTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061229738 Original CRISPR CAGTTTCTCCATCTTGTACA TGG (reversed) Intergenic
No off target data available for this crispr