ID: 1061229740

View in Genome Browser
Species Human (GRCh38)
Location 9:129308275-129308297
Sequence AACTGAGGCATGAGAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061229738_1061229740 -5 Left 1061229738 9:129308257-129308279 CCATGTACAAGATGGAGAAACTG No data
Right 1061229740 9:129308275-129308297 AACTGAGGCATGAGAAGAACTGG No data
1061229737_1061229740 -4 Left 1061229737 9:129308256-129308278 CCCATGTACAAGATGGAGAAACT No data
Right 1061229740 9:129308275-129308297 AACTGAGGCATGAGAAGAACTGG No data
1061229735_1061229740 19 Left 1061229735 9:129308233-129308255 CCAAGCGATCATATGTATAAACT No data
Right 1061229740 9:129308275-129308297 AACTGAGGCATGAGAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061229740 Original CRISPR AACTGAGGCATGAGAAGAAC TGG Intergenic
No off target data available for this crispr