ID: 1061229741

View in Genome Browser
Species Human (GRCh38)
Location 9:129308293-129308315
Sequence ACTGGTTACCGACTTGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061229737_1061229741 14 Left 1061229737 9:129308256-129308278 CCCATGTACAAGATGGAGAAACT No data
Right 1061229741 9:129308293-129308315 ACTGGTTACCGACTTGACCCAGG No data
1061229738_1061229741 13 Left 1061229738 9:129308257-129308279 CCATGTACAAGATGGAGAAACTG No data
Right 1061229741 9:129308293-129308315 ACTGGTTACCGACTTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061229741 Original CRISPR ACTGGTTACCGACTTGACCC AGG Intergenic
No off target data available for this crispr