ID: 1061231793

View in Genome Browser
Species Human (GRCh38)
Location 9:129319763-129319785
Sequence CAGTGTCCCCATTGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061231793_1061231801 8 Left 1061231793 9:129319763-129319785 CCACCTTCCCAATGGGGACACTG No data
Right 1061231801 9:129319794-129319816 AGAGCTCGAGCCATTCACTCAGG No data
1061231793_1061231802 9 Left 1061231793 9:129319763-129319785 CCACCTTCCCAATGGGGACACTG No data
Right 1061231802 9:129319795-129319817 GAGCTCGAGCCATTCACTCAGGG No data
1061231793_1061231804 21 Left 1061231793 9:129319763-129319785 CCACCTTCCCAATGGGGACACTG No data
Right 1061231804 9:129319807-129319829 TTCACTCAGGGTCGCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061231793 Original CRISPR CAGTGTCCCCATTGGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr