ID: 1061232023

View in Genome Browser
Species Human (GRCh38)
Location 9:129320709-129320731
Sequence CCCTGCCCAGAGCAACCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061232023_1061232035 25 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232035 9:129320757-129320779 CACGTTCTGTTCCCCGCTTTCGG No data
1061232023_1061232031 -2 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232031 9:129320730-129320752 GGCGGTCCGCAGCTCGGGGGCGG No data
1061232023_1061232038 30 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232038 9:129320762-129320784 TCTGTTCCCCGCTTTCGGGCGGG No data
1061232023_1061232027 -8 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232027 9:129320724-129320746 GGGCAGGGCGGTCCGCAGCTCGG No data
1061232023_1061232030 -5 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232030 9:129320727-129320749 CAGGGCGGTCCGCAGCTCGGGGG No data
1061232023_1061232036 26 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232036 9:129320758-129320780 ACGTTCTGTTCCCCGCTTTCGGG No data
1061232023_1061232037 29 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232037 9:129320761-129320783 TTCTGTTCCCCGCTTTCGGGCGG No data
1061232023_1061232028 -7 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232028 9:129320725-129320747 GGCAGGGCGGTCCGCAGCTCGGG No data
1061232023_1061232029 -6 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232029 9:129320726-129320748 GCAGGGCGGTCCGCAGCTCGGGG No data
1061232023_1061232032 1 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232032 9:129320733-129320755 GGTCCGCAGCTCGGGGGCGGCGG No data
1061232023_1061232033 2 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232033 9:129320734-129320756 GTCCGCAGCTCGGGGGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061232023 Original CRISPR CCCTGCCCAGAGCAACCCCC GGG (reversed) Intergenic