ID: 1061232025

View in Genome Browser
Species Human (GRCh38)
Location 9:129320710-129320732
Sequence GCCCTGCCCAGAGCAACCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061232025_1061232029 -7 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232029 9:129320726-129320748 GCAGGGCGGTCCGCAGCTCGGGG No data
1061232025_1061232038 29 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232038 9:129320762-129320784 TCTGTTCCCCGCTTTCGGGCGGG No data
1061232025_1061232036 25 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232036 9:129320758-129320780 ACGTTCTGTTCCCCGCTTTCGGG No data
1061232025_1061232037 28 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232037 9:129320761-129320783 TTCTGTTCCCCGCTTTCGGGCGG No data
1061232025_1061232032 0 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232032 9:129320733-129320755 GGTCCGCAGCTCGGGGGCGGCGG No data
1061232025_1061232028 -8 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232028 9:129320725-129320747 GGCAGGGCGGTCCGCAGCTCGGG No data
1061232025_1061232031 -3 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232031 9:129320730-129320752 GGCGGTCCGCAGCTCGGGGGCGG No data
1061232025_1061232035 24 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232035 9:129320757-129320779 CACGTTCTGTTCCCCGCTTTCGG No data
1061232025_1061232039 30 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232039 9:129320763-129320785 CTGTTCCCCGCTTTCGGGCGGGG No data
1061232025_1061232030 -6 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232030 9:129320727-129320749 CAGGGCGGTCCGCAGCTCGGGGG No data
1061232025_1061232033 1 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232033 9:129320734-129320756 GTCCGCAGCTCGGGGGCGGCGGG No data
1061232025_1061232027 -9 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232027 9:129320724-129320746 GGGCAGGGCGGTCCGCAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061232025 Original CRISPR GCCCTGCCCAGAGCAACCCC CGG (reversed) Intergenic