ID: 1061232034

View in Genome Browser
Species Human (GRCh38)
Location 9:129320736-129320758
Sequence TGCCCGCCGCCCCCGAGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061232034_1061232036 -1 Left 1061232034 9:129320736-129320758 CCGCAGCTCGGGGGCGGCGGGCA No data
Right 1061232036 9:129320758-129320780 ACGTTCTGTTCCCCGCTTTCGGG No data
1061232034_1061232038 3 Left 1061232034 9:129320736-129320758 CCGCAGCTCGGGGGCGGCGGGCA No data
Right 1061232038 9:129320762-129320784 TCTGTTCCCCGCTTTCGGGCGGG No data
1061232034_1061232043 12 Left 1061232034 9:129320736-129320758 CCGCAGCTCGGGGGCGGCGGGCA No data
Right 1061232043 9:129320771-129320793 CGCTTTCGGGCGGGGACCGCAGG No data
1061232034_1061232035 -2 Left 1061232034 9:129320736-129320758 CCGCAGCTCGGGGGCGGCGGGCA No data
Right 1061232035 9:129320757-129320779 CACGTTCTGTTCCCCGCTTTCGG No data
1061232034_1061232044 24 Left 1061232034 9:129320736-129320758 CCGCAGCTCGGGGGCGGCGGGCA No data
Right 1061232044 9:129320783-129320805 GGGACCGCAGGCTCCAGCCCCGG No data
1061232034_1061232045 27 Left 1061232034 9:129320736-129320758 CCGCAGCTCGGGGGCGGCGGGCA No data
Right 1061232045 9:129320786-129320808 ACCGCAGGCTCCAGCCCCGGCGG No data
1061232034_1061232039 4 Left 1061232034 9:129320736-129320758 CCGCAGCTCGGGGGCGGCGGGCA No data
Right 1061232039 9:129320763-129320785 CTGTTCCCCGCTTTCGGGCGGGG No data
1061232034_1061232037 2 Left 1061232034 9:129320736-129320758 CCGCAGCTCGGGGGCGGCGGGCA No data
Right 1061232037 9:129320761-129320783 TTCTGTTCCCCGCTTTCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061232034 Original CRISPR TGCCCGCCGCCCCCGAGCTG CGG (reversed) Intergenic