ID: 1061232037

View in Genome Browser
Species Human (GRCh38)
Location 9:129320761-129320783
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061232023_1061232037 29 Left 1061232023 9:129320709-129320731 CCCGGGGGTTGCTCTGGGCAGGG No data
Right 1061232037 9:129320761-129320783 TTCTGTTCCCCGCTTTCGGGCGG No data
1061232025_1061232037 28 Left 1061232025 9:129320710-129320732 CCGGGGGTTGCTCTGGGCAGGGC No data
Right 1061232037 9:129320761-129320783 TTCTGTTCCCCGCTTTCGGGCGG No data
1061232021_1061232037 30 Left 1061232021 9:129320708-129320730 CCCCGGGGGTTGCTCTGGGCAGG No data
Right 1061232037 9:129320761-129320783 TTCTGTTCCCCGCTTTCGGGCGG No data
1061232034_1061232037 2 Left 1061232034 9:129320736-129320758 CCGCAGCTCGGGGGCGGCGGGCA No data
Right 1061232037 9:129320761-129320783 TTCTGTTCCCCGCTTTCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061232037 Original CRISPR TTCTGTTCCCCGCTTTCGGG CGG Intergenic
No off target data available for this crispr