ID: 1061243011

View in Genome Browser
Species Human (GRCh38)
Location 9:129385172-129385194
Sequence TTCCCAGGACACTCCCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061243011_1061243017 21 Left 1061243011 9:129385172-129385194 CCCAAAAGGGAGTGTCCTGGGAA No data
Right 1061243017 9:129385216-129385238 CAATGAGTAAGGCCTTGGCCAGG No data
1061243011_1061243018 22 Left 1061243011 9:129385172-129385194 CCCAAAAGGGAGTGTCCTGGGAA No data
Right 1061243018 9:129385217-129385239 AATGAGTAAGGCCTTGGCCAGGG No data
1061243011_1061243014 10 Left 1061243011 9:129385172-129385194 CCCAAAAGGGAGTGTCCTGGGAA No data
Right 1061243014 9:129385205-129385227 GTGTACTTCTCCAATGAGTAAGG No data
1061243011_1061243015 16 Left 1061243011 9:129385172-129385194 CCCAAAAGGGAGTGTCCTGGGAA No data
Right 1061243015 9:129385211-129385233 TTCTCCAATGAGTAAGGCCTTGG No data
1061243011_1061243019 29 Left 1061243011 9:129385172-129385194 CCCAAAAGGGAGTGTCCTGGGAA No data
Right 1061243019 9:129385224-129385246 AAGGCCTTGGCCAGGGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061243011 Original CRISPR TTCCCAGGACACTCCCTTTT GGG (reversed) Intergenic
No off target data available for this crispr