ID: 1061243114

View in Genome Browser
Species Human (GRCh38)
Location 9:129385825-129385847
Sequence CAGGGTGGTGCAGTGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061243104_1061243114 12 Left 1061243104 9:129385790-129385812 CCTTTGCCTTCCTAACAGTATCA No data
Right 1061243114 9:129385825-129385847 CAGGGTGGTGCAGTGACTGCTGG No data
1061243101_1061243114 18 Left 1061243101 9:129385784-129385806 CCCGTCCCTTTGCCTTCCTAACA No data
Right 1061243114 9:129385825-129385847 CAGGGTGGTGCAGTGACTGCTGG No data
1061243102_1061243114 17 Left 1061243102 9:129385785-129385807 CCGTCCCTTTGCCTTCCTAACAG No data
Right 1061243114 9:129385825-129385847 CAGGGTGGTGCAGTGACTGCTGG No data
1061243108_1061243114 2 Left 1061243108 9:129385800-129385822 CCTAACAGTATCAGCTGGGCCCA No data
Right 1061243114 9:129385825-129385847 CAGGGTGGTGCAGTGACTGCTGG No data
1061243103_1061243114 13 Left 1061243103 9:129385789-129385811 CCCTTTGCCTTCCTAACAGTATC No data
Right 1061243114 9:129385825-129385847 CAGGGTGGTGCAGTGACTGCTGG No data
1061243106_1061243114 6 Left 1061243106 9:129385796-129385818 CCTTCCTAACAGTATCAGCTGGG No data
Right 1061243114 9:129385825-129385847 CAGGGTGGTGCAGTGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061243114 Original CRISPR CAGGGTGGTGCAGTGACTGC TGG Intergenic
No off target data available for this crispr