ID: 1061245589

View in Genome Browser
Species Human (GRCh38)
Location 9:129399879-129399901
Sequence CGGTAGACAGCAGTGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061245580_1061245589 3 Left 1061245580 9:129399853-129399875 CCCACAGGGGCCCAGGAAGAGCG No data
Right 1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG No data
1061245581_1061245589 2 Left 1061245581 9:129399854-129399876 CCACAGGGGCCCAGGAAGAGCGT No data
Right 1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG No data
1061245573_1061245589 26 Left 1061245573 9:129399830-129399852 CCTCAGCCACAGGCAGTCCTTGT No data
Right 1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG No data
1061245583_1061245589 -7 Left 1061245583 9:129399863-129399885 CCCAGGAAGAGCGTCCCGGTAGA No data
Right 1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG No data
1061245579_1061245589 9 Left 1061245579 9:129399847-129399869 CCTTGTCCCACAGGGGCCCAGGA No data
Right 1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG No data
1061245584_1061245589 -8 Left 1061245584 9:129399864-129399886 CCAGGAAGAGCGTCCCGGTAGAC No data
Right 1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG No data
1061245574_1061245589 20 Left 1061245574 9:129399836-129399858 CCACAGGCAGTCCTTGTCCCACA No data
Right 1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061245589 Original CRISPR CGGTAGACAGCAGTGGCAGA GGG Intergenic
No off target data available for this crispr