ID: 1061246940

View in Genome Browser
Species Human (GRCh38)
Location 9:129405401-129405423
Sequence CGGGGGGAACAAAAGGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061246923_1061246940 26 Left 1061246923 9:129405352-129405374 CCAGAGCTCAGGGGCCCTGTTCC No data
Right 1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG No data
1061246927_1061246940 4 Left 1061246927 9:129405374-129405396 CCCAGTTTTCTGTGCCCAGCAGA No data
Right 1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG No data
1061246926_1061246940 5 Left 1061246926 9:129405373-129405395 CCCCAGTTTTCTGTGCCCAGCAG No data
Right 1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG No data
1061246928_1061246940 3 Left 1061246928 9:129405375-129405397 CCAGTTTTCTGTGCCCAGCAGAA No data
Right 1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG No data
1061246925_1061246940 11 Left 1061246925 9:129405367-129405389 CCTGTTCCCCAGTTTTCTGTGCC No data
Right 1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG No data
1061246934_1061246940 -10 Left 1061246934 9:129405388-129405410 CCCAGCAGAAGAGCGGGGGGAAC No data
Right 1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG No data
1061246924_1061246940 12 Left 1061246924 9:129405366-129405388 CCCTGTTCCCCAGTTTTCTGTGC No data
Right 1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061246940 Original CRISPR CGGGGGGAACAAAAGGGGGA CGG Intergenic
No off target data available for this crispr