ID: 1061247693

View in Genome Browser
Species Human (GRCh38)
Location 9:129409385-129409407
Sequence TTAGTTCAGAGGGTCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061247693_1061247702 6 Left 1061247693 9:129409385-129409407 CCCCCAGAGACCCTCTGAACTAA No data
Right 1061247702 9:129409414-129409436 CACCCCAAGGAGCAGCTGCAGGG No data
1061247693_1061247709 14 Left 1061247693 9:129409385-129409407 CCCCCAGAGACCCTCTGAACTAA No data
Right 1061247709 9:129409422-129409444 GGAGCAGCTGCAGGGTTTGGGGG No data
1061247693_1061247710 20 Left 1061247693 9:129409385-129409407 CCCCCAGAGACCCTCTGAACTAA No data
Right 1061247710 9:129409428-129409450 GCTGCAGGGTTTGGGGGTCCAGG No data
1061247693_1061247708 13 Left 1061247693 9:129409385-129409407 CCCCCAGAGACCCTCTGAACTAA No data
Right 1061247708 9:129409421-129409443 AGGAGCAGCTGCAGGGTTTGGGG No data
1061247693_1061247699 -7 Left 1061247693 9:129409385-129409407 CCCCCAGAGACCCTCTGAACTAA No data
Right 1061247699 9:129409401-129409423 GAACTAACCACTGCACCCCAAGG No data
1061247693_1061247706 11 Left 1061247693 9:129409385-129409407 CCCCCAGAGACCCTCTGAACTAA No data
Right 1061247706 9:129409419-129409441 CAAGGAGCAGCTGCAGGGTTTGG No data
1061247693_1061247707 12 Left 1061247693 9:129409385-129409407 CCCCCAGAGACCCTCTGAACTAA No data
Right 1061247707 9:129409420-129409442 AAGGAGCAGCTGCAGGGTTTGGG No data
1061247693_1061247711 27 Left 1061247693 9:129409385-129409407 CCCCCAGAGACCCTCTGAACTAA No data
Right 1061247711 9:129409435-129409457 GGTTTGGGGGTCCAGGACTGAGG No data
1061247693_1061247701 5 Left 1061247693 9:129409385-129409407 CCCCCAGAGACCCTCTGAACTAA No data
Right 1061247701 9:129409413-129409435 GCACCCCAAGGAGCAGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061247693 Original CRISPR TTAGTTCAGAGGGTCTCTGG GGG (reversed) Intergenic
No off target data available for this crispr