ID: 1061247837

View in Genome Browser
Species Human (GRCh38)
Location 9:129410191-129410213
Sequence CGAGGTCCACAGTAAGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061247837_1061247844 -1 Left 1061247837 9:129410191-129410213 CCACGCCCTTACTGTGGACCTCG No data
Right 1061247844 9:129410213-129410235 GGGCCTCTGGAACCGTCAGACGG No data
1061247837_1061247846 9 Left 1061247837 9:129410191-129410213 CCACGCCCTTACTGTGGACCTCG No data
Right 1061247846 9:129410223-129410245 AACCGTCAGACGGCTCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061247837 Original CRISPR CGAGGTCCACAGTAAGGGCG TGG (reversed) Intergenic
No off target data available for this crispr