ID: 1061249062

View in Genome Browser
Species Human (GRCh38)
Location 9:129415999-129416021
Sequence CTGGGGACACAGCTGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061249054_1061249062 27 Left 1061249054 9:129415949-129415971 CCCACTTTCACAGATGAAGGGGC No data
Right 1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG No data
1061249057_1061249062 0 Left 1061249057 9:129415976-129415998 CCTCAGAGAGGTGAAGTCACTTG No data
Right 1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG No data
1061249055_1061249062 26 Left 1061249055 9:129415950-129415972 CCACTTTCACAGATGAAGGGGCA No data
Right 1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061249062 Original CRISPR CTGGGGACACAGCTGGAAGA TGG Intergenic
No off target data available for this crispr