ID: 1061250409

View in Genome Browser
Species Human (GRCh38)
Location 9:129423067-129423089
Sequence CGTGGCACCCAGCAGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061250409_1061250425 12 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250425 9:129423102-129423124 GCCGAGGAGGGGGTGGGGCGGGG No data
1061250409_1061250422 7 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250422 9:129423097-129423119 CCTTTGCCGAGGAGGGGGTGGGG No data
1061250409_1061250424 11 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250424 9:129423101-129423123 TGCCGAGGAGGGGGTGGGGCGGG No data
1061250409_1061250428 14 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250428 9:129423104-129423126 CGAGGAGGGGGTGGGGCGGGGGG No data
1061250409_1061250416 1 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250416 9:129423091-129423113 GGCTGCCCTTTGCCGAGGAGGGG No data
1061250409_1061250417 2 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250417 9:129423092-129423114 GCTGCCCTTTGCCGAGGAGGGGG No data
1061250409_1061250420 6 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250420 9:129423096-129423118 CCCTTTGCCGAGGAGGGGGTGGG No data
1061250409_1061250413 -4 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250413 9:129423086-129423108 CACGTGGCTGCCCTTTGCCGAGG No data
1061250409_1061250415 0 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250415 9:129423090-129423112 TGGCTGCCCTTTGCCGAGGAGGG No data
1061250409_1061250414 -1 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250414 9:129423089-129423111 GTGGCTGCCCTTTGCCGAGGAGG No data
1061250409_1061250418 5 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250418 9:129423095-129423117 GCCCTTTGCCGAGGAGGGGGTGG No data
1061250409_1061250427 13 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250427 9:129423103-129423125 CCGAGGAGGGGGTGGGGCGGGGG No data
1061250409_1061250423 10 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250423 9:129423100-129423122 TTGCCGAGGAGGGGGTGGGGCGG No data
1061250409_1061250429 29 Left 1061250409 9:129423067-129423089 CCCGGCTGCTGCTGGGTGCCACG No data
Right 1061250429 9:129423119-129423141 GCGGGGGGTGTACATTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061250409 Original CRISPR CGTGGCACCCAGCAGCAGCC GGG (reversed) Intergenic