ID: 1061251714

View in Genome Browser
Species Human (GRCh38)
Location 9:129430231-129430253
Sequence GATCCCAGTGGACCCTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061251714_1061251719 3 Left 1061251714 9:129430231-129430253 CCCTCTCAGGGTCCACTGGGATC No data
Right 1061251719 9:129430257-129430279 TATTTAGTATTAAGGAGATTGGG No data
1061251714_1061251717 -5 Left 1061251714 9:129430231-129430253 CCCTCTCAGGGTCCACTGGGATC No data
Right 1061251717 9:129430249-129430271 GGATCTTTTATTTAGTATTAAGG No data
1061251714_1061251720 4 Left 1061251714 9:129430231-129430253 CCCTCTCAGGGTCCACTGGGATC No data
Right 1061251720 9:129430258-129430280 ATTTAGTATTAAGGAGATTGGGG No data
1061251714_1061251723 15 Left 1061251714 9:129430231-129430253 CCCTCTCAGGGTCCACTGGGATC No data
Right 1061251723 9:129430269-129430291 AGGAGATTGGGGGAGGTATGAGG No data
1061251714_1061251721 5 Left 1061251714 9:129430231-129430253 CCCTCTCAGGGTCCACTGGGATC No data
Right 1061251721 9:129430259-129430281 TTTAGTATTAAGGAGATTGGGGG No data
1061251714_1061251718 2 Left 1061251714 9:129430231-129430253 CCCTCTCAGGGTCCACTGGGATC No data
Right 1061251718 9:129430256-129430278 TTATTTAGTATTAAGGAGATTGG No data
1061251714_1061251722 8 Left 1061251714 9:129430231-129430253 CCCTCTCAGGGTCCACTGGGATC No data
Right 1061251722 9:129430262-129430284 AGTATTAAGGAGATTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061251714 Original CRISPR GATCCCAGTGGACCCTGAGA GGG (reversed) Intergenic
No off target data available for this crispr