ID: 1061252891

View in Genome Browser
Species Human (GRCh38)
Location 9:129437051-129437073
Sequence CGCGCGCGCGTGCCTGACCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061252890_1061252891 13 Left 1061252890 9:129437015-129437037 CCTTATGTTGTGCGTGTGAGTGT No data
Right 1061252891 9:129437051-129437073 CGCGCGCGCGTGCCTGACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061252891 Original CRISPR CGCGCGCGCGTGCCTGACCG CGG Intergenic