ID: 1061254431

View in Genome Browser
Species Human (GRCh38)
Location 9:129445985-129446007
Sequence CCCTGCTGGCACCTTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8840
Summary {0: 39, 1: 381, 2: 1291, 3: 2716, 4: 4413}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061254431_1061254444 25 Left 1061254431 9:129445985-129446007 CCAAGATCAAGGTGCCAGCAGGG 0: 39
1: 381
2: 1291
3: 2716
4: 4413
Right 1061254444 9:129446033-129446055 CCTGGCTCGCCTGTGTCCTCAGG No data
1061254431_1061254436 7 Left 1061254431 9:129445985-129446007 CCAAGATCAAGGTGCCAGCAGGG 0: 39
1: 381
2: 1291
3: 2716
4: 4413
Right 1061254436 9:129446015-129446037 CTTCCAAGGCCCTCCCTCCCTGG No data
1061254431_1061254445 28 Left 1061254431 9:129445985-129446007 CCAAGATCAAGGTGCCAGCAGGG 0: 39
1: 381
2: 1291
3: 2716
4: 4413
Right 1061254445 9:129446036-129446058 GGCTCGCCTGTGTCCTCAGGTGG No data
1061254431_1061254435 -7 Left 1061254431 9:129445985-129446007 CCAAGATCAAGGTGCCAGCAGGG 0: 39
1: 381
2: 1291
3: 2716
4: 4413
Right 1061254435 9:129446001-129446023 AGCAGGGCTGGTTTCTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061254431 Original CRISPR CCCTGCTGGCACCTTGATCT TGG (reversed) Intergenic
Too many off-targets to display for this crispr