ID: 1061254436

View in Genome Browser
Species Human (GRCh38)
Location 9:129446015-129446037
Sequence CTTCCAAGGCCCTCCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061254434_1061254436 -7 Left 1061254434 9:129445999-129446021 CCAGCAGGGCTGGTTTCTTCCAA No data
Right 1061254436 9:129446015-129446037 CTTCCAAGGCCCTCCCTCCCTGG No data
1061254431_1061254436 7 Left 1061254431 9:129445985-129446007 CCAAGATCAAGGTGCCAGCAGGG 0: 39
1: 381
2: 1291
3: 2716
4: 4413
Right 1061254436 9:129446015-129446037 CTTCCAAGGCCCTCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061254436 Original CRISPR CTTCCAAGGCCCTCCCTCCC TGG Intergenic
No off target data available for this crispr