ID: 1061254437

View in Genome Browser
Species Human (GRCh38)
Location 9:129446018-129446040
Sequence GAGCCAGGGAGGGAGGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061254437_1061254444 -8 Left 1061254437 9:129446018-129446040 CCAAGGCCCTCCCTCCCTGGCTC No data
Right 1061254444 9:129446033-129446055 CCTGGCTCGCCTGTGTCCTCAGG No data
1061254437_1061254445 -5 Left 1061254437 9:129446018-129446040 CCAAGGCCCTCCCTCCCTGGCTC No data
Right 1061254445 9:129446036-129446058 GGCTCGCCTGTGTCCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061254437 Original CRISPR GAGCCAGGGAGGGAGGGCCT TGG (reversed) Intergenic
No off target data available for this crispr