ID: 1061254444

View in Genome Browser
Species Human (GRCh38)
Location 9:129446033-129446055
Sequence CCTGGCTCGCCTGTGTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061254437_1061254444 -8 Left 1061254437 9:129446018-129446040 CCAAGGCCCTCCCTCCCTGGCTC No data
Right 1061254444 9:129446033-129446055 CCTGGCTCGCCTGTGTCCTCAGG No data
1061254434_1061254444 11 Left 1061254434 9:129445999-129446021 CCAGCAGGGCTGGTTTCTTCCAA No data
Right 1061254444 9:129446033-129446055 CCTGGCTCGCCTGTGTCCTCAGG No data
1061254431_1061254444 25 Left 1061254431 9:129445985-129446007 CCAAGATCAAGGTGCCAGCAGGG 0: 39
1: 381
2: 1291
3: 2716
4: 4413
Right 1061254444 9:129446033-129446055 CCTGGCTCGCCTGTGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061254444 Original CRISPR CCTGGCTCGCCTGTGTCCTC AGG Intergenic
No off target data available for this crispr