ID: 1061256308

View in Genome Browser
Species Human (GRCh38)
Location 9:129455641-129455663
Sequence ACTCGCCTCTAAGGCAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061256308_1061256318 27 Left 1061256308 9:129455641-129455663 CCAAAGCTGCCTTAGAGGCGAGT No data
Right 1061256318 9:129455691-129455713 ACCTTCAGGGGGAGATGCTCAGG No data
1061256308_1061256311 13 Left 1061256308 9:129455641-129455663 CCAAAGCTGCCTTAGAGGCGAGT No data
Right 1061256311 9:129455677-129455699 TCTGCCCTGCCATCACCTTCAGG No data
1061256308_1061256313 15 Left 1061256308 9:129455641-129455663 CCAAAGCTGCCTTAGAGGCGAGT No data
Right 1061256313 9:129455679-129455701 TGCCCTGCCATCACCTTCAGGGG No data
1061256308_1061256320 28 Left 1061256308 9:129455641-129455663 CCAAAGCTGCCTTAGAGGCGAGT No data
Right 1061256320 9:129455692-129455714 CCTTCAGGGGGAGATGCTCAGGG No data
1061256308_1061256314 16 Left 1061256308 9:129455641-129455663 CCAAAGCTGCCTTAGAGGCGAGT No data
Right 1061256314 9:129455680-129455702 GCCCTGCCATCACCTTCAGGGGG No data
1061256308_1061256312 14 Left 1061256308 9:129455641-129455663 CCAAAGCTGCCTTAGAGGCGAGT No data
Right 1061256312 9:129455678-129455700 CTGCCCTGCCATCACCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061256308 Original CRISPR ACTCGCCTCTAAGGCAGCTT TGG (reversed) Intergenic