ID: 1061256310

View in Genome Browser
Species Human (GRCh38)
Location 9:129455650-129455672
Sequence GCCATCAGCACTCGCCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061256310_1061256321 22 Left 1061256310 9:129455650-129455672 CCTTAGAGGCGAGTGCTGATGGC No data
Right 1061256321 9:129455695-129455717 TCAGGGGGAGATGCTCAGGGTGG No data
1061256310_1061256314 7 Left 1061256310 9:129455650-129455672 CCTTAGAGGCGAGTGCTGATGGC No data
Right 1061256314 9:129455680-129455702 GCCCTGCCATCACCTTCAGGGGG No data
1061256310_1061256313 6 Left 1061256310 9:129455650-129455672 CCTTAGAGGCGAGTGCTGATGGC No data
Right 1061256313 9:129455679-129455701 TGCCCTGCCATCACCTTCAGGGG No data
1061256310_1061256312 5 Left 1061256310 9:129455650-129455672 CCTTAGAGGCGAGTGCTGATGGC No data
Right 1061256312 9:129455678-129455700 CTGCCCTGCCATCACCTTCAGGG No data
1061256310_1061256318 18 Left 1061256310 9:129455650-129455672 CCTTAGAGGCGAGTGCTGATGGC No data
Right 1061256318 9:129455691-129455713 ACCTTCAGGGGGAGATGCTCAGG No data
1061256310_1061256311 4 Left 1061256310 9:129455650-129455672 CCTTAGAGGCGAGTGCTGATGGC No data
Right 1061256311 9:129455677-129455699 TCTGCCCTGCCATCACCTTCAGG No data
1061256310_1061256320 19 Left 1061256310 9:129455650-129455672 CCTTAGAGGCGAGTGCTGATGGC No data
Right 1061256320 9:129455692-129455714 CCTTCAGGGGGAGATGCTCAGGG No data
1061256310_1061256323 24 Left 1061256310 9:129455650-129455672 CCTTAGAGGCGAGTGCTGATGGC No data
Right 1061256323 9:129455697-129455719 AGGGGGAGATGCTCAGGGTGGGG No data
1061256310_1061256322 23 Left 1061256310 9:129455650-129455672 CCTTAGAGGCGAGTGCTGATGGC No data
Right 1061256322 9:129455696-129455718 CAGGGGGAGATGCTCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061256310 Original CRISPR GCCATCAGCACTCGCCTCTA AGG (reversed) Intergenic