ID: 1061256320

View in Genome Browser
Species Human (GRCh38)
Location 9:129455692-129455714
Sequence CCTTCAGGGGGAGATGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061256308_1061256320 28 Left 1061256308 9:129455641-129455663 CCAAAGCTGCCTTAGAGGCGAGT No data
Right 1061256320 9:129455692-129455714 CCTTCAGGGGGAGATGCTCAGGG No data
1061256310_1061256320 19 Left 1061256310 9:129455650-129455672 CCTTAGAGGCGAGTGCTGATGGC No data
Right 1061256320 9:129455692-129455714 CCTTCAGGGGGAGATGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061256320 Original CRISPR CCTTCAGGGGGAGATGCTCA GGG Intergenic
No off target data available for this crispr