ID: 1061256412

View in Genome Browser
Species Human (GRCh38)
Location 9:129456183-129456205
Sequence GGACAAGCTGGTCTGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061256412_1061256424 17 Left 1061256412 9:129456183-129456205 CCCAGTTCCAGACCAGCTTGTCC No data
Right 1061256424 9:129456223-129456245 AGGACTGGCTCAGGTGCCCATGG No data
1061256412_1061256419 2 Left 1061256412 9:129456183-129456205 CCCAGTTCCAGACCAGCTTGTCC No data
Right 1061256419 9:129456208-129456230 CTAGTGCCTGGTCCCAGGACTGG No data
1061256412_1061256417 -3 Left 1061256412 9:129456183-129456205 CCCAGTTCCAGACCAGCTTGTCC No data
Right 1061256417 9:129456203-129456225 TCCTGCTAGTGCCTGGTCCCAGG No data
1061256412_1061256416 -10 Left 1061256412 9:129456183-129456205 CCCAGTTCCAGACCAGCTTGTCC No data
Right 1061256416 9:129456196-129456218 CAGCTTGTCCTGCTAGTGCCTGG No data
1061256412_1061256421 8 Left 1061256412 9:129456183-129456205 CCCAGTTCCAGACCAGCTTGTCC No data
Right 1061256421 9:129456214-129456236 CCTGGTCCCAGGACTGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061256412 Original CRISPR GGACAAGCTGGTCTGGAACT GGG (reversed) Intergenic
No off target data available for this crispr