ID: 1061256413

View in Genome Browser
Species Human (GRCh38)
Location 9:129456184-129456206
Sequence AGGACAAGCTGGTCTGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061256413_1061256424 16 Left 1061256413 9:129456184-129456206 CCAGTTCCAGACCAGCTTGTCCT No data
Right 1061256424 9:129456223-129456245 AGGACTGGCTCAGGTGCCCATGG No data
1061256413_1061256421 7 Left 1061256413 9:129456184-129456206 CCAGTTCCAGACCAGCTTGTCCT No data
Right 1061256421 9:129456214-129456236 CCTGGTCCCAGGACTGGCTCAGG No data
1061256413_1061256417 -4 Left 1061256413 9:129456184-129456206 CCAGTTCCAGACCAGCTTGTCCT No data
Right 1061256417 9:129456203-129456225 TCCTGCTAGTGCCTGGTCCCAGG No data
1061256413_1061256419 1 Left 1061256413 9:129456184-129456206 CCAGTTCCAGACCAGCTTGTCCT No data
Right 1061256419 9:129456208-129456230 CTAGTGCCTGGTCCCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061256413 Original CRISPR AGGACAAGCTGGTCTGGAAC TGG (reversed) Intergenic