ID: 1061256416

View in Genome Browser
Species Human (GRCh38)
Location 9:129456196-129456218
Sequence CAGCTTGTCCTGCTAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061256409_1061256416 24 Left 1061256409 9:129456149-129456171 CCACACAGCAGGTTGGAAGCAGA No data
Right 1061256416 9:129456196-129456218 CAGCTTGTCCTGCTAGTGCCTGG No data
1061256412_1061256416 -10 Left 1061256412 9:129456183-129456205 CCCAGTTCCAGACCAGCTTGTCC No data
Right 1061256416 9:129456196-129456218 CAGCTTGTCCTGCTAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061256416 Original CRISPR CAGCTTGTCCTGCTAGTGCC TGG Intergenic
No off target data available for this crispr