ID: 1061256418

View in Genome Browser
Species Human (GRCh38)
Location 9:129456204-129456226
Sequence TCCTGGGACCAGGCACTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061256418_1061256424 -4 Left 1061256418 9:129456204-129456226 CCTGCTAGTGCCTGGTCCCAGGA No data
Right 1061256424 9:129456223-129456245 AGGACTGGCTCAGGTGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061256418 Original CRISPR TCCTGGGACCAGGCACTAGC AGG (reversed) Intergenic
No off target data available for this crispr