ID: 1061256421

View in Genome Browser
Species Human (GRCh38)
Location 9:129456214-129456236
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061256415_1061256421 -4 Left 1061256415 9:129456195-129456217 CCAGCTTGTCCTGCTAGTGCCTG No data
Right 1061256421 9:129456214-129456236 CCTGGTCCCAGGACTGGCTCAGG No data
1061256412_1061256421 8 Left 1061256412 9:129456183-129456205 CCCAGTTCCAGACCAGCTTGTCC No data
Right 1061256421 9:129456214-129456236 CCTGGTCCCAGGACTGGCTCAGG No data
1061256413_1061256421 7 Left 1061256413 9:129456184-129456206 CCAGTTCCAGACCAGCTTGTCCT No data
Right 1061256421 9:129456214-129456236 CCTGGTCCCAGGACTGGCTCAGG No data
1061256414_1061256421 1 Left 1061256414 9:129456190-129456212 CCAGACCAGCTTGTCCTGCTAGT No data
Right 1061256421 9:129456214-129456236 CCTGGTCCCAGGACTGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061256421 Original CRISPR CCTGGTCCCAGGACTGGCTC AGG Intergenic