ID: 1061257148

View in Genome Browser
Species Human (GRCh38)
Location 9:129459752-129459774
Sequence TGGTGTACGCTGCAGTGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061257148_1061257163 30 Left 1061257148 9:129459752-129459774 CCCCGCCACTGCAGCGTACACCA No data
Right 1061257163 9:129459805-129459827 GAAACTGAGGCCAGAGATCAGGG No data
1061257148_1061257157 7 Left 1061257148 9:129459752-129459774 CCCCGCCACTGCAGCGTACACCA No data
Right 1061257157 9:129459782-129459804 GGGATCCTTGCTTTACAACCAGG No data
1061257148_1061257158 8 Left 1061257148 9:129459752-129459774 CCCCGCCACTGCAGCGTACACCA No data
Right 1061257158 9:129459783-129459805 GGATCCTTGCTTTACAACCAGGG No data
1061257148_1061257162 29 Left 1061257148 9:129459752-129459774 CCCCGCCACTGCAGCGTACACCA No data
Right 1061257162 9:129459804-129459826 GGAAACTGAGGCCAGAGATCAGG No data
1061257148_1061257160 17 Left 1061257148 9:129459752-129459774 CCCCGCCACTGCAGCGTACACCA No data
Right 1061257160 9:129459792-129459814 CTTTACAACCAGGGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061257148 Original CRISPR TGGTGTACGCTGCAGTGGCG GGG (reversed) Intergenic
No off target data available for this crispr