ID: 1061258163

View in Genome Browser
Species Human (GRCh38)
Location 9:129464879-129464901
Sequence CTAAGATTCCCACAGGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061258153_1061258163 11 Left 1061258153 9:129464845-129464867 CCCACCGGAGCCAGCAAGGTGGG No data
Right 1061258163 9:129464879-129464901 CTAAGATTCCCACAGGGACCAGG No data
1061258148_1061258163 17 Left 1061258148 9:129464839-129464861 CCATCCCCCACCGGAGCCAGCAA No data
Right 1061258163 9:129464879-129464901 CTAAGATTCCCACAGGGACCAGG No data
1061258151_1061258163 12 Left 1061258151 9:129464844-129464866 CCCCACCGGAGCCAGCAAGGTGG No data
Right 1061258163 9:129464879-129464901 CTAAGATTCCCACAGGGACCAGG No data
1061258156_1061258163 7 Left 1061258156 9:129464849-129464871 CCGGAGCCAGCAAGGTGGGATGG No data
Right 1061258163 9:129464879-129464901 CTAAGATTCCCACAGGGACCAGG No data
1061258160_1061258163 1 Left 1061258160 9:129464855-129464877 CCAGCAAGGTGGGATGGGGTTGA No data
Right 1061258163 9:129464879-129464901 CTAAGATTCCCACAGGGACCAGG No data
1061258147_1061258163 18 Left 1061258147 9:129464838-129464860 CCCATCCCCCACCGGAGCCAGCA No data
Right 1061258163 9:129464879-129464901 CTAAGATTCCCACAGGGACCAGG No data
1061258150_1061258163 13 Left 1061258150 9:129464843-129464865 CCCCCACCGGAGCCAGCAAGGTG No data
Right 1061258163 9:129464879-129464901 CTAAGATTCCCACAGGGACCAGG No data
1061258155_1061258163 10 Left 1061258155 9:129464846-129464868 CCACCGGAGCCAGCAAGGTGGGA No data
Right 1061258163 9:129464879-129464901 CTAAGATTCCCACAGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061258163 Original CRISPR CTAAGATTCCCACAGGGACC AGG Intergenic
No off target data available for this crispr