ID: 1061264873

View in Genome Browser
Species Human (GRCh38)
Location 9:129499089-129499111
Sequence GGTTCCAGAGTGACCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061264873_1061264879 7 Left 1061264873 9:129499089-129499111 CCAGCCCTGGTCACTCTGGAACC No data
Right 1061264879 9:129499119-129499141 AGCATCTGAGCCCCTCCTCAAGG No data
1061264873_1061264881 17 Left 1061264873 9:129499089-129499111 CCAGCCCTGGTCACTCTGGAACC No data
Right 1061264881 9:129499129-129499151 CCCCTCCTCAAGGAGCCCAGTGG No data
1061264873_1061264887 25 Left 1061264873 9:129499089-129499111 CCAGCCCTGGTCACTCTGGAACC No data
Right 1061264887 9:129499137-129499159 CAAGGAGCCCAGTGGCTGGAGGG No data
1061264873_1061264884 21 Left 1061264873 9:129499089-129499111 CCAGCCCTGGTCACTCTGGAACC No data
Right 1061264884 9:129499133-129499155 TCCTCAAGGAGCCCAGTGGCTGG No data
1061264873_1061264886 24 Left 1061264873 9:129499089-129499111 CCAGCCCTGGTCACTCTGGAACC No data
Right 1061264886 9:129499136-129499158 TCAAGGAGCCCAGTGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061264873 Original CRISPR GGTTCCAGAGTGACCAGGGC TGG (reversed) Intergenic
No off target data available for this crispr