ID: 1061271582

View in Genome Browser
Species Human (GRCh38)
Location 9:129546767-129546789
Sequence TGCCAGGCCAGCCCTACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061271582_1061271588 5 Left 1061271582 9:129546767-129546789 CCTAGTGTAGGGCTGGCCTGGCA No data
Right 1061271588 9:129546795-129546817 AAGGGGCCTCATCTCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061271582 Original CRISPR TGCCAGGCCAGCCCTACACT AGG (reversed) Intergenic
No off target data available for this crispr