ID: 1061274276

View in Genome Browser
Species Human (GRCh38)
Location 9:129560511-129560533
Sequence CTGGATCAGTGGCAAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061274271_1061274276 -3 Left 1061274271 9:129560491-129560513 CCGGGCAGAGGGAATGGGGTCTG No data
Right 1061274276 9:129560511-129560533 CTGGATCAGTGGCAAGAGGTGGG No data
1061274262_1061274276 20 Left 1061274262 9:129560468-129560490 CCTGGGTAGCTATAAGGGATCAC No data
Right 1061274276 9:129560511-129560533 CTGGATCAGTGGCAAGAGGTGGG No data
1061274258_1061274276 27 Left 1061274258 9:129560461-129560483 CCGCAGCCCTGGGTAGCTATAAG No data
Right 1061274276 9:129560511-129560533 CTGGATCAGTGGCAAGAGGTGGG No data
1061274270_1061274276 -2 Left 1061274270 9:129560490-129560512 CCCGGGCAGAGGGAATGGGGTCT No data
Right 1061274276 9:129560511-129560533 CTGGATCAGTGGCAAGAGGTGGG No data
1061274261_1061274276 21 Left 1061274261 9:129560467-129560489 CCCTGGGTAGCTATAAGGGATCA No data
Right 1061274276 9:129560511-129560533 CTGGATCAGTGGCAAGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061274276 Original CRISPR CTGGATCAGTGGCAAGAGGT GGG Intergenic
No off target data available for this crispr